Apollo Lemmon on

DNA

GCGGCGATGGCGGATGAACTTATGGATGTCATGGGCGAAATGGTTGAGCTTATGTAGGAGGGCGCGCTTGTGATGGCGGCGATGGCGGGCTACCTTATGGATGTCATGGGCGAAATGGTTGAGCTTATGCTGGATTACGATGGACTTGTG

DNA-o-gram

general

1 comment on “DNA”

Leave a Reply

This site uses Akismet to reduce spam. Learn how your comment data is processed.

Your post must include a link to this post.

How does this work?
Write a response on your own website and include a link to this post. Then submit your response’s URL here. Your response may appear here after moderation. To update or remove it, edit or delete your original post and submit the same URL again. Learn more about Webmentions.